View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-28-LTR4-TNT-insertion-8 (Length: 248)
Name: Tnk88-28-LTR4-TNT-insertion-8
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-28-LTR4-TNT-insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 65 - 240
Target Start/End: Complemental strand, 36632705 - 36632526
Alignment:
| Q |
65 |
catgatatgatgcacgatttgcgtgcattttgtcttgacttgcaaatccatgagattgcatattgcttgcttcaccgtccttaattgtctgtctcccccg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36632705 |
catgatatgatgcacgatttgcgtgcattttgtcttaacttgcaaatccacgagattgcatattgcttgcttcaccgtccttaattgtctgtctcccccg |
36632606 |
T |
|
| Q |
165 |
tgaaccattcgaatttaggcaattatata----actcttctgctaagattcttcctcgtttatcttctattttattatta |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36632605 |
tgaaccattcgaatttaggcaattatataaactactcttctgctaagattcttcctcgtttatcttctattttattatta |
36632526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University