View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-28-LTR4-TNT-insertion-9 (Length: 73)
Name: Tnk88-28-LTR4-TNT-insertion-9
Description: Tnk88-28-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-28-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 48295577 - 48295520
Alignment:
| Q |
9 |
catatccttttctgcgataagtctaatatagtctagagatgacaaagctaaacaattg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48295577 |
catatccttttctgcgataagtctaatatagtctagagatgacaaagctaaacaattg |
48295520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 48306892 - 48306835
Alignment:
| Q |
9 |
catatccttttctgcgataagtctaatatagtctagagatgacaaagctaaacaattg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48306892 |
catatccttttctgcgataagtctaatatagtctagagatgacaaagctaaacaattg |
48306835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University