View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-32-LTR4-TNT-insertion-22 (Length: 109)
Name: Tnk88-32-LTR4-TNT-insertion-22
Description: Tnk88-32-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-32-LTR4-TNT-insertion-22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 5e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 7 - 98
Target Start/End: Complemental strand, 13561554 - 13561464
Alignment:
| Q |
7 |
atcaattactggaggattagtcgtatatataatcgtccctaaataaatatttcatgtaacgggctaccttattgaccttccttctagagaat |
98 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13561554 |
atcaattactggaggattaatcgtatatataatcgtccctaaataaata-ttcatgtaacgggctaccttattgaccttccttctagagaat |
13561464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 14204143 - 14204222
Alignment:
| Q |
19 |
aggattagtcgtatatataatcgtccctaaataaatatttcatgtaacgggctaccttattgaccttccttctagagaatt |
99 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||||| | ||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14204143 |
aggattaatcatatatataaccgtccctaaataaatact-catttaacgggctaccttattggccttccttctagagaatt |
14204222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University