View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-32-LTR4-TNT-insertion-26 (Length: 133)
Name: Tnk88-32-LTR4-TNT-insertion-26
Description: Tnk88-32-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-32-LTR4-TNT-insertion-26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 51334201 - 51334082
Alignment:
| Q |
8 |
cattttatatatataggtgtctgtagtaattattattatatacgtacgtacgtagttttctttttaactcaacgtgtgtatagttacgtagcttactgat |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
51334201 |
cattttatatatataggtgtctctagtaattattattatatacgtacgtacgtagttttctttttaactcaacgtgtgtatagttaggtagcttattgat |
51334102 |
T |
 |
| Q |
108 |
atttatgtacaaacaattgg |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51334101 |
atttatgtacaaacaattgg |
51334082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University