View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-35-LTR4-TNT-insertion-5 (Length: 271)
Name: Tnk88-35-LTR4-TNT-insertion-5
Description: Tnk88-35-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-35-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 19 - 189
Target Start/End: Complemental strand, 5313505 - 5313334
Alignment:
| Q |
19 |
tcgattcgattcgcggcggcgatacccccaaattgcacgtgagttcccactcatctgtaatttagtaactagttaattaaaatatgtaaagataactgta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
5313505 |
tcgattcgattcgcggcggcgatacccccaaattgcacgtgagttcccactcgtctgtaatttagtatctagttaattaaaatatgtaaagataattgta |
5313406 |
T |
 |
| Q |
119 |
catgttgtttaatcccnnnnnnncttagaaagatctatagcttatattacgtgatgga-tttaattaaatct |
189 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5313405 |
catgttgtttaatccctttttttcttagaaagatctatagcttatattacgtgatggattttaattaaatct |
5313334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University