View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-35-LTR4-TNT-insertion-6 (Length: 270)
Name: Tnk88-35-LTR4-TNT-insertion-6
Description: Tnk88-35-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-35-LTR4-TNT-insertion-6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 9 - 261
Target Start/End: Complemental strand, 6672057 - 6671805
Alignment:
| Q |
9 |
gaacccaagtatgcaaaacacattcctcaaaccactttccaaaaactatatttgtagggcgctactcaaaacatatttcctctttatccgaaaaatgaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6672057 |
gaacccaagtatgcaaaacacattcctcaaacccctttccaaaaactatatttgtagggcgctactcaaaacatatttcctctttatccgaaaaatgaat |
6671958 |
T |
|
| Q |
109 |
ttcaccatcttaaatttgcaccatagatgaatgaggtggtggagaagtggcatggggagattgggaattgagataaggagaaataagatggggagaacga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6671957 |
ttcaccatcttaaatttgcaccatagatgaatgaggtggtggagaagtggcgtggggagattgggaattgagataaggagaaataagatggggagaacga |
6671858 |
T |
|
| Q |
209 |
gaatggtgacaatgtacnnnnnnnnggagtgtgaaattgaattgttggaattg |
261 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6671857 |
gaatggcgacaatgtacgtttttttggagtgtgaaattgaattgttggaattg |
6671805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 110 - 225
Target Start/End: Original strand, 36854768 - 36854883
Alignment:
| Q |
110 |
tcaccatcttaaatttgcaccatagatgaatgaggtggtggagaagtggcatggggagattgggaattgagataaggagaaataagatggggagaacgag |
209 |
Q |
| |
|
||||||||| |||| |||| || |||||||||||| ||||||||||||||| | ||||||||||||||||||| |||||||| | || | |||||||||| |
|
|
| T |
36854768 |
tcaccatctaaaatctgcatcaaagatgaatgaggcggtggagaagtggcacgaggagattgggaattgagatgaggagaaagaggacgaggagaacgag |
36854867 |
T |
|
| Q |
210 |
aatggtgacaatgtac |
225 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
36854868 |
aatggccacaatgtac |
36854883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University