View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-37-LTR4-TNT-insertion-10 (Length: 207)
Name: Tnk88-37-LTR4-TNT-insertion-10
Description: Tnk88-37-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-37-LTR4-TNT-insertion-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 51845080 - 51844895
Alignment:
| Q |
10 |
atcgagatgtaactcaccgaggaaacgaagatttgttaatgagtctggtatatttcctgagaatttattattgttgagccgtactttcttgagagaacct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51845080 |
atcgagatgtaactcaccgaggaaacgaagatttgttaatgagtctggtatatttcctgagaatttattattgttgagccatactttcttgagagaacct |
51844981 |
T |
|
| Q |
110 |
aaatgagagaaaaaatctggaggaataggtcctgagaattggtttaatgataaataaagagctttaagagcaccaagtttgttgaa |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51844980 |
aaatgagaaaaaaaatctggaggaataggtcctgagaattggtttaatgataaataaagagctttaagagcaccaagtttgttgaa |
51844895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University