View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-37-LTR4-TNT-insertion-5 (Length: 150)
Name: Tnk88-37-LTR4-TNT-insertion-5
Description: Tnk88-37-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-37-LTR4-TNT-insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 7 - 141
Target Start/End: Complemental strand, 36574101 - 36573967
Alignment:
| Q |
7 |
acatgcatggtgaagtgtagaggacttaccatgagaaaatgaggaaagccattgctaattgtctattggatgtggctcttttgtattcttctttagactt |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574101 |
acatgcatggtgaagagtagaggacttaccatgagaaaatgaggaaagccattgctaattgtctattggatgtggctcttttgtattcttctttagactt |
36574002 |
T |
|
| Q |
107 |
tatgcaaatgcacccaccaagtacgtgagcaattg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36574001 |
tatgcaaatgcacccaccaagtacgtgagcaattg |
36573967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 30 - 104
Target Start/End: Original strand, 2548899 - 2548973
Alignment:
| Q |
30 |
acttaccatgagaaaatgaggaaagccattgctaattgtctattggatgtggctcttttgtattcttctttagac |
104 |
Q |
| |
|
|||||||| ||||||||||| |||||||| | ||||||| |||||| ||||||| | |||||| ||||||||| |
|
|
| T |
2548899 |
acttaccaagagaaaatgagaaaagccatagataattgtttattggctgtggctgatctgtattggtctttagac |
2548973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University