View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-37-LTR4-TNT-insertion-6 (Length: 92)
Name: Tnk88-37-LTR4-TNT-insertion-6
Description: Tnk88-37-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-37-LTR4-TNT-insertion-6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 5e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 5e-22
Query Start/End: Original strand, 10 - 74
Target Start/End: Complemental strand, 6843647 - 6843583
Alignment:
| Q |
10 |
gcactttgattccatcaaattacattgttaccaaatgacacgacgataggtgcatgttgtgaatt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
6843647 |
gcactttgattccatcaaattacattgttaccaaatgacacgacgatatgcacatgttgtgaatt |
6843583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University