View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-4-LTR4-TNT-insertion-4 (Length: 342)
Name: Tnk88-4-LTR4-TNT-insertion-4
Description: Tnk88-4-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-4-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 8 - 333
Target Start/End: Complemental strand, 26955819 - 26955494
Alignment:
| Q |
8 |
tacttgtctgtttggcttttgctaacaaattgaatgaaccaaaaaatttgtatggatcgagattattccttgtatgggaatttatgtacgatgtttctgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26955819 |
tacttgtctgtttggcttttgctaacaaattgaatgaaccaaaaattttgtatggatcaagattattccttgtatgggaatttatgtacgatgtttctgt |
26955720 |
T |
 |
| Q |
108 |
ggttgcaaacttgatgtttgtcccttactagtactactgatgtcgacattggtggttagtactacttgatttttgccccttgttactagtgcttgttgga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26955719 |
ggttgcaaacttgatgtttgtcccttactagtactactgatgtcgacattggtggttagtactacttgatttttgccccttgttactagttcttgttgga |
26955620 |
T |
 |
| Q |
208 |
tttgaattttatcgtatcaatttgattaattttctcatttatagaggtattcatataaaatcaataattgataacatgtaaacatgtaaaattaaatctt |
307 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26955619 |
tttgaattttatcgtatcatgttgattaattttctcatttatagaggtattcatataaaatcaataattgataacatgtaaacatgtaaaattaaatctt |
26955520 |
T |
 |
| Q |
308 |
gaatgtgttaaaaatattagcaattg |
333 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26955519 |
gaatgtgttaaaaatattagcaattg |
26955494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University