View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-40-LTR4-TNT-insertion-1 (Length: 412)
Name: Tnk88-40-LTR4-TNT-insertion-1
Description: Tnk88-40-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-40-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 7 - 403
Target Start/End: Complemental strand, 10522298 - 10521902
Alignment:
| Q |
7 |
aggttttatagtgtggctaaatctatattcgacgatttatggtcatttggtatgcatgtatttgagnnnnnnnnnggagagagcgttatgagaggttctt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10522298 |
aggttttatcgtgtggctaaatctatattcgacgatttatggtcatttagtatgcatgtatttgagtttttttttggagagagcgttatgagaggttctt |
10522199 |
T |
 |
| Q |
107 |
taagaacatggttggattgctgccggaaggtatgttggaagcaataaaaattgacttggaaatggctaaaaatcaaactgtctagcttaaactactatct |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522198 |
taagaacatggtcggattgctgccggaaggtatgttggaagcaataaaaattgacttggaaatggctaaaaatcaaactgtctagcttaaactactatct |
10522099 |
T |
 |
| Q |
207 |
tagacgagggaatttaaatcccttggactgtttaggttgattttctgcttttcaggtcattaatggttaaattgttgacagttccagcccttaagttggt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522098 |
tagacgagggaatttaaatcccttggactgtttaggttgattttctgcttttcaggtcattaatggttaaattgttgacagttccagcccttaagttggt |
10521999 |
T |
 |
| Q |
307 |
gggaacttttcggtgtgatattatgtgttggttctttaactttcaggagttttggtaagaggtaagagaatccggctgggttagtgagccgcaattg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
10521998 |
gggaacttttcggtgtgatattatgtgttggttctttaactttcaggagttttggtaagaggtaagagaatccggcaggattagtgagccgcaattg |
10521902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University