View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Tnk88-40-LTR4-TNT-insertion-7 (Length: 393)
Name: Tnk88-40-LTR4-TNT-insertion-7
Description: Tnk88-40-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Tnk88-40-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 8 - 383
Target Start/End: Complemental strand, 4346114 - 4345739
Alignment:
| Q |
8 |
atgcattctttatctcggttgtcctctagtatctctcggcaacagtcgcggttattatggttacaagattgtgatgccaactcaaagtactttcatgtaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4346114 |
atgcattctttatctcggttgtcctctagtatctcttgccaacagtcgcggttattatggttacaagattgtgatgtcaactcaaagtactttcatgtag |
4346015 |
T |
|
| Q |
108 |
tcatgacgggaaggcggcgtgttaattcgatttcatctcttgttgtcaacggtagcattgttgaaggtgttcatccggtgcgtgaagcggtatttaatta |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4346014 |
tcatgacgggaaggtggcgtgttaattcgatttcatctcttgttgtcaacggtagcattgttgaaggtgttcatccggtgcgtgaagtggtatttaatta |
4345915 |
T |
|
| Q |
208 |
tttttctgatcagttcaagtctattgaatccgtgaggcctaatatggatgggatggtatttcgacaacttgataatggggatggggtgcctcttgtgcgc |
307 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4345914 |
tttttcagatcagttcaagtctattgaatccgtgaggcctagtatggatgggatggtatttcgacaacttgattatggggatggggtgcctcttgtgcgc |
4345815 |
T |
|
| Q |
308 |
cctttttctattgatgaggtgaaggccgcggtgtgggattgcgacagtttcaatagttcaggtcctgatggaatta |
383 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
4345814 |
cctttttctatcgatgaggtgaaggcggcggtgtgggattgcgacaatttcaaaagtccaggtcctgatggaatta |
4345739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 228 - 375
Target Start/End: Complemental strand, 19044167 - 19044020
Alignment:
| Q |
228 |
ctattgaatccgtgaggcctaatatggatgggatggtatttcgacaacttgataatggggatggggtgcctcttgtgcgccctttttctattgatgaggt |
327 |
Q |
| |
|
|||||||| ||||||||||| | |||| ||||||| | ||| || ||||| ||||||||||||| ||||||||||||| |||||||| || ||||| |
|
|
| T |
19044167 |
ctattgaagtcgtgaggcctagtgtggaagggatggattctcggcaccttgactatggggatggggtctctcttgtgcgccccttttctatagaagaggt |
19044068 |
T |
|
| Q |
328 |
gaaggccgcggtgtgggattgcgacagtttcaatagttcaggtcctga |
375 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
19044067 |
gaaggtggctgtgtgggattgtgacagtttcaaaagtccaggtcctga |
19044020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University