View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_14_20 (Length: 86)
Name: 108_14_20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_14_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 29324849 - 29324803
Alignment:
| Q |
1 |
tcaangtcatcttgcctttcctacttcgctnattaaatatatgaatc |
47 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29324849 |
tcaacgtcatcttgcctttcctacttcgcttattaaatatatgaatc |
29324803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 83
Target Start/End: Complemental strand, 29324882 - 29324848
Alignment:
| Q |
49 |
attcctttttcggtgcttttcctatttcgcttatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29324882 |
attcctttttcggtgcttttcctatttcgcttatc |
29324848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15968 times since January 2019
Visitors: 3757