View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_18_26 (Length: 392)
Name: 108_18_26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_18_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 124 - 352
Target Start/End: Original strand, 9699312 - 9699538
Alignment:
| Q |
124 |
attaatcgccagagtaaatccccttcgggctgtgttgataaaattgggtcttcattgaaacggggagcctcgtagtatgctttaaaaattcctgaaaata |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9699312 |
attaatcgccagagtaaatccccttcgggctgtgttgataaaattgggtcttcattgaaacggggagcctggtagtatgctttaaaaattcctgaaaata |
9699411 |
T |
|
| Q |
224 |
ccattgaaaccaatccggcaaagatgattcccacgccttgcattgcgaaaactgctgctatgaaagcgcctcgtgtccttttgttggcatattcnnacat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
9699412 |
ccattgaaaccaatccggcaaagatgattcccacgccttgcattgcgaaaactgctgctatgaaagcgcctcgtgtccttttgttggcgtattcagacat |
9699511 |
T |
|
| Q |
324 |
ggatggttgcctgataaagggtagtctcc |
352 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
9699512 |
-gatggttg-ctgataaagggtagtctcc |
9699538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 9699828 - 9699941
Alignment:
| Q |
1 |
caagcaaccatgataatgagtgtgacaccntaaactttcttgcgtccaagtttgtctccgagccagccgaagactaattggccagaaagtgttccgacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699828 |
caagcaaccatgataatgagtgtgacaccataaactttcttgcgtccaagtttgtctccgagccagccgaagactaattggccagaaagtgttccgacaa |
9699927 |
T |
|
| Q |
101 |
gggccacaccggtg |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9699928 |
gggccacaccggtg |
9699941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16468 times since January 2019
Visitors: 3768