View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_20_59 (Length: 265)
Name: 108_20_59
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_20_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 12038510 - 12038419
Alignment:
| Q |
1 |
gatacgtgggaagatcttcgtaatagatatacctgaaactttgtagaaacatcttctctatgtgaggttctggnttgcagaatcgagccntcg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
12038510 |
gatacgtgggaagatcttcgtaatagatatacctgaaactttgtagaaacatcttctctatgtgaggttctgg-ttgcagaatcgagccctcg |
12038419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9837 times since January 2019
Visitors: 7932