View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_21_52 (Length: 279)
Name: 108_21_52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_21_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 4589284 - 4589058
Alignment:
| Q |
1 |
tgatgcacatatcaaaaaacatcttaaaagctgcca--gactatggtgattgaatgaaaggcatcctaatggaagccgccacaaactggggtgcttgact |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4589284 |
tgatgcacatatcaaaaaacatcttaaaagctgccacagactatggtgattgaatgaaaggcatcctaatggaagctgccacaaactggggtgcttgact |
4589185 |
T |
|
| Q |
99 |
ctaacatagatacaactttcttcacaaattgaagctacacttcttttggtttctgtgtttgcagtgagaagggtgccttttacgcaacaagcatgcttac |
198 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4589184 |
ctaacatggatacaaccttcttcacaaattgaagctacacttcttttggtttctgtgtttgcagtgagaagggtgccttttacgcaataagcatgcttac |
4589085 |
T |
|
| Q |
199 |
cattccctgcttccacgcatcgcaatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
4589084 |
cattccctgcttccacgcatcgcaatt |
4589058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 4589337 - 4589280
Alignment:
| Q |
222 |
aattcagcccttgatctgtgagtatcagacctatctgatgatgagaacgacagtgatg |
279 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4589337 |
aattcaaccattgatctgtgagtatcagacctatctgatgatgagaacgacagtgatg |
4589280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12240 times since January 2019
Visitors: 8179