View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_6_75 (Length: 424)
Name: 108_6_75
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_6_75 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 9e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 219 - 414
Target Start/End: Original strand, 52229969 - 52230163
Alignment:
| Q |
219 |
agtcaaagaaatttcagaatctgtgttttttagtcaaattaanttcaggatcaaagacnccncaattaatcaactactagtncgttcattttttcagtgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| || ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52229969 |
agtcaaagaaatttcagaatctgtgttttttagtcaaattaatttcagaatcaaagactcctcaattaatcaactactagttcgttcattttttcagtgt |
52230068 |
T |
|
| Q |
319 |
tatcngtgtcttgttttncaagagcgaaatattcttgcngctntgtccaacttnaggtaggtgtcctagtatgttcnatccatccaattatgccac |
414 |
Q |
| |
|
|||| |||||||||||| |||||| ||||||||||||| ||| ||||||| || |||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
52230069 |
tatctgtgtcttgtttttcaagagtgaaatattcttgctgctttgtccaatttaaggtaggtgt-ctagtatgttctatccatccaattatgccac |
52230163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 52229751 - 52229882
Alignment:
| Q |
1 |
gatggcaccacttatcgcaaggtacttttacttccttctcactcttttgagatcttgtttttcttcttcttaattcatgattttgtatcttcatttttac |
100 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52229751 |
gatggcaccacttatcgcagggtaattttacttccttctcactcttttgagatcttgtttttcttcttcttaattcatgattttgtatcttcatttttac |
52229850 |
T |
|
| Q |
101 |
tgttggattcaaatcttgctataattggttcg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52229851 |
tgttggattcaaatcttgctataattggttcg |
52229882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8006 times since January 2019
Visitors: 7737