View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_6_89 (Length: 196)
Name: 108_6_89
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_6_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 41480681 - 41480866
Alignment:
| Q |
1 |
ctcctcacctgatcgtctttcctcagccaattccatccgtcaggtttttctatactaatnccccnttgaataaaatattagttcaacgcttgagaaatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41480681 |
ctcctcacctgatcgtctttcctcagccaattccatccgtcaggtttttctatactaattttc-tttgaataaaatattagttcaacgcttgcgaaatta |
41480779 |
T |
|
| Q |
101 |
atgcaaatattgttaataatataggcatgtgttgagtatggtttcttttaccttgtgaaccacggngtgganaaagattttatgaag |
187 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
41480780 |
atgcaaatatgtttaataatataggcatgtgttgagtatggtttcttttaccttgtgaaccacggtgtggacaaagattttatgaag |
41480866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 41494584 - 41494642
Alignment:
| Q |
1 |
ctcctcacctgatcgtctttcctcagccaattccatccgtcaggtttttctatactaat |
59 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41494584 |
ctcctcacctgatcgtctatccacagccaattccatccgtcaggtttttctctactaat |
41494642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 183
Target Start/End: Original strand, 41489916 - 41489979
Alignment:
| Q |
120 |
tataggcatgtgttgagtatggtttcttttaccttgtgaaccacggngtgganaaagattttat |
183 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||| ||||| | |||||||| |
|
|
| T |
41489916 |
tataggcatgcgttgagtatggttttttttaccttgtgaaccacggtgtggacgaggattttat |
41489979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 187
Target Start/End: Original strand, 41494719 - 41494786
Alignment:
| Q |
120 |
tataggcatgtgttgagtatggtttcttttaccttgtgaaccacggngtgganaaagattttatgaag |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| || ||| | | |||||||||||| |
|
|
| T |
41494719 |
tataggcatgcgttgagtatggtttcttttaccttgtgaaccatggtgtgaatgaggattttatgaag |
41494786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12508 times since January 2019
Visitors: 8218