View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_7_14 (Length: 123)
Name: 108_7_14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_7_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 8e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 38911862 - 38911923
Alignment:
| Q |
1 |
gaaggcgcttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaattaatc |
62 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38911862 |
gaaggcacttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaattaatc |
38911923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 56 - 123
Target Start/End: Original strand, 38911800 - 38911866
Alignment:
| Q |
56 |
attaatcttggtgaagtgcattaccggcantcanaagtatgaagaggngcggtcttgttatgagaagg |
123 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
38911800 |
attaatcttggtgaagtgcattaccgg-actcagaagtatgaagaggcgcggtcttgttatgagaagg |
38911866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16282 times since January 2019
Visitors: 3768