View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_7_27 (Length: 190)
Name: 108_7_27
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_7_27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 46696112 - 46695924
Alignment:
| Q |
1 |
tacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcantgn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46696112 |
tacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcattgc |
46696013 |
T |
|
| Q |
101 |
taggaataaccttttggacaaatcaatgnatanagtttcntcngggnaatgtaaatnaaatatattcncatgaagaagctcttaagaatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||| || ||| ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
46696012 |
taggaataaccttttggacaaatcaatgcataaagtttcatctggg-aatgtaaataaaatatattcacatgaagaagctcttaagaatt |
46695924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14929 times since January 2019
Visitors: 8422