View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_7_46 (Length: 131)
Name: 108_7_46
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_7_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 3e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 38911869 - 38911923
Alignment:
| Q |
8 |
cttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaatnaatc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38911869 |
cttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaattaatc |
38911923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 59 - 122
Target Start/End: Original strand, 38911803 - 38911866
Alignment:
| Q |
59 |
aatcntggtgaagtgnattancggaatnanatgtatgaagaggngcggtcttgttntgagaagg |
122 |
Q |
| |
|
|||| |||||||||| |||| |||| | | | ||||||||||| ||||||||||| |||||||| |
|
|
| T |
38911803 |
aatcttggtgaagtgcattaccggactcagaagtatgaagaggcgcggtcttgttatgagaagg |
38911866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11919 times since January 2019
Visitors: 8179