View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 11737-6_high_3 (Length: 213)
Name: 11737-6_high_3
Description: 11737-6
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 11737-6_high_3 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 52727199 - 52727017
Alignment:
Q |
19 |
cagaagtggtagagaggggattgcatatagtgaaggagtacttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagtcttgggttgg |
118 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52727199 |
cagaagtcgtagagaggggattgcatatagtgaaggagtacttgtgcaacaagatgaatgctggtcatcaaagcccaacaaagaagaagtcttgggttgg |
52727100 |
T |
|
Q |
119 |
aaggttggtcaagtatggaacattcaatgttagaagtggagctcgtgaagaacatgaggctttcatcctccccgagtataatc |
201 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52727099 |
aaggttggtcaagtatggaacattcaatgttagaagtggagctcgtgaagaacatgaggctttcatcctccccgagtataatc |
52727017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21037 times since January 2019
Visitors: 2988