View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 11737-6_low_2 (Length: 254)
Name: 11737-6_low_2
Description: 11737-6
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 11737-6_low_2 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 40498148 - 40497909
Alignment:
Q |
15 |
atgaacaacacatatcccagttctttaataattctcgtttgtttaattttcctctacaatatagtgtcctggtaaacttgtttttgtatattcttacttt |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
40498148 |
atgaacaacacatatcccagttctttaataattctcgtttgtttaattttcctctacaatatagtgtcctagtaaacttgtttttgtatattcttacttt |
40498049 |
T |
|
Q |
115 |
catattggtaaccaaaaggtacgttgtttctttgttttgtgttgccatgtttcaaagactcttttgtaacataacatgtacttagtagtaaattaactct |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
40498048 |
catattggtaaccaaaaggtacgttgtttctttgttttgtgttgccatgtttcaaagactcttttgtaacataacatgtacttagtagtaatttaactct |
40497949 |
T |
|
Q |
215 |
atttcatttttgaacagattttggcatctaatggcaaata |
254 |
Q |
|
|
||||||||||| |||||||||||| || |||||||||||| |
|
|
T |
40497948 |
atttcattttttaacagattttggtatttaatggcaaata |
40497909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19140 times since January 2019
Visitors: 2570