View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 11737_high_3 (Length: 398)
Name: 11737_high_3
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 11737_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Complemental strand, 46586931 - 46586552
Alignment:
| Q |
1 |
tctatttgatacaatggatagtatatcaaacgtgatttattgaaaatgattcttaactcaatccaaatcacctctgcttatgaatggttgtagatgatca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46586931 |
tctatttgatacaatgggtagtatatcaaacgtgatttattgaaaatgattcttaactcaatcaaaatcacctctgcttatgaatggttgtagatgatca |
46586832 |
T |
|
| Q |
101 |
caacttataatttttatgaatatcattctcaaagttatatggtgaaatgttttgaaaaaagttgatgatgcatgggaaatttaatggacggtgggttgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
46586831 |
caacttataatttttatgaatatcattctcaaagttatatggtaaaatgttttgaaaaa-gttgatggtgcatgggaaatttgatggacggtgggttgat |
46586733 |
T |
|
| Q |
201 |
gacaatatagatatgtggaaggtgtgactcccaatcatttgtggttcaattctttcacattcgaaggttgaatcatcgcaataaatcaatggcccatttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46586732 |
gacaatatagatatgtggaaggtgtgactcccaatcatttgtggttcaattctttcacattcgaaggttgaatcatcgcaataaatcaatggcccatttc |
46586633 |
T |
|
| Q |
301 |
attaaattctccatatggatacagatcgccatcaatccactagtttcagctctagtttgtgtccaattaatatgtcacacc |
381 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46586632 |
tttaaattctccagatggatacagatcgccatcaatccattagtttcagctctagtttgtgtccaattaacatgtcacacc |
46586552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4517 times since January 2019
Visitors: 7475