View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 11737_low_7 (Length: 234)
Name: 11737_low_7
Description: 11737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 11737_low_7 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 37173732 - 37173529
Alignment:
Q |
18 |
aattttgctgttaaattgagtttgaacgactatggtgaatagattcccaatactactacgagggatgtgtagctcactgagtaaaggaagtaagcaataa |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
T |
37173732 |
aattttgctgttaaattgagtttgaacgactatgttgaatagatacccaatactactacgagggatgtatagttcactgagtaaaggaagtaaacaataa |
37173633 |
T |
|
Q |
118 |
atgttcatgactcaaatcctgacaataatagtat--atatgttttatagaaatttcattttgaaacttattttaaatccatatataaattgaaagtaacc |
215 |
Q |
|
|
|| ||||||| || |||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37173632 |
atattcatgattcgaatcctgacaataatagtatatatatgtttgatagaaatttcattttgaaacttattttaaatccatatataaattgaaagtaacc |
37173533 |
T |
|
Q |
216 |
tttg |
219 |
Q |
|
|
|||| |
|
|
T |
37173532 |
tttg |
37173529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 36507 times since January 2019
Visitors: 7121