View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-1 (Length: 56)
Name: 454-NF4349-Insertion-1
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-1 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.00000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.00000000000006
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 6920840 - 6920886
Alignment:
Q |
1 |
ataataactcaaaaagtgacataaaataagtcat-aatattgcttat |
46 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
6920840 |
ataataactcaaaaagtgacataaaataagtcataaatattgcttat |
6920886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 764 times since January 2019
Visitors: 5257