View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-2 (Length: 210)
Name: 454-NF4349-Insertion-2
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-2 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 210
Target Start/End: Original strand, 37055158 - 37055360
Alignment:
Q |
8 |
aaaaccttgtttctcttcattctcatctaaacctgagattttctgaacctgcttcttttcattttcttgttctttcatgtaatagttatcttgtaaagta |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37055158 |
aaaaccttgtttctcttcattctcatctaaacctgagattttctgaacctgcttcttttcattttcttgttctttcatgtaatagttatcttgtaaagta |
37055257 |
T |
|
Q |
108 |
tgaacatggaagcttccagctgcattgattaaagcaccaacactcaaaatgtgagtcctttgtgatgatgataaaggaaccaagagtgtgataatgatga |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37055258 |
tgaacatggaagcttccagctgcattgattaaagcaccaacactcaaaatgtgagtcctttgtgatgatgataaaggaaccaagagtgtgataatgatga |
37055357 |
T |
|
Q |
208 |
tga |
210 |
Q |
|
|
||| |
|
|
T |
37055358 |
tga |
37055360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2216 times since January 2019
Visitors: 6082