View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-22 (Length: 107)
Name: 454-NF4349-Insertion-22
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-22 |
| |
|
[»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 4 - 107
Target Start/End: Original strand, 48080608 - 48080711
Alignment:
Q |
4 |
aaatagaagttcttgaatgtttataaactttgagtgtttgagtgttcattgtacacaattgatgtttcaaccttgttttgaatttttgttgggacatttg |
103 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48080608 |
aaatagaagttcttgattgtttataaactttgagtgtttgagtgttcattgtacacaattgatgtttcaaccttgttttgaatttttgttgggacatttt |
48080707 |
T |
|
Q |
104 |
ttag |
107 |
Q |
|
|
|||| |
|
|
T |
48080708 |
ttag |
48080711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1186 times since January 2019
Visitors: 5623