View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-25 (Length: 140)
Name: 454-NF4349-Insertion-25
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4349-Insertion-25 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 12936178 - 12936039
Alignment:
| Q |
1 |
gatgcatagtaaaaggaagtaatagtttgaaatatgaatgagaaagcaagatgtatctagttgatattgctcttgaatgccatcaaagacattcttacaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12936178 |
gatgcatagtacaaggaagtaatagtttgaaatatgaatgagaaagcaagatgcatctagttgatattgctcttgaatgacatcaaagacattcttacaa |
12936079 |
T |
|
| Q |
101 |
attgtatgattcgaaaactaagaacttgatggcaaacaga |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12936078 |
attgtatgattcgaaaactaagaacttgatggcaaacaga |
12936039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19117 times since January 2019
Visitors: 2565