View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-9 (Length: 172)
Name: 454-NF4349-Insertion-9
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-9 |
| |
|
[»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 5 - 172
Target Start/End: Original strand, 36671371 - 36671538
Alignment:
Q |
5 |
acaaacatgttacacaagaaccaaacctccatctcaaagtatcaagcagatgaccccatgtacttagagagattaacctcattaagaagcccaaaatatg |
104 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
36671371 |
acaaacatgttacacaagagccaaacctccatctcaaagtattatgcagatgaccccatgtacttagagagattagcctcattaagaagcccaaaatatg |
36671470 |
T |
|
Q |
105 |
taaacgcacgaaaccaaccttacaatttaacaatctcttagccacttggaggaagaacttctttacat |
172 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
36671471 |
caaaggcacgaaaccaaccttacaatttaacaatctcttagccactgggaggaagaacttctttacat |
36671538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3350 times since January 2019
Visitors: 8610