View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4352-Insertion-1 (Length: 90)
Name: 454-NF4352-Insertion-1
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4352-Insertion-1 |
| |
|
[»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 2e-39
Query Start/End: Original strand, 5 - 90
Target Start/End: Original strand, 38783337 - 38783422
Alignment:
Q |
5 |
atgaccctttcaacaatgatgaaaaatgtgacctcattaattttccaagtgatacaatatacatcttaagaggatattctttttca |
90 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38783337 |
atgaccctttcaacaatgttgaaaaatgtgacctcattaattttccaagtgatacaatatacatcttaagaggatattctttttca |
38783422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 58
Target Start/End: Complemental strand, 5051096 - 5051043
Alignment:
Q |
5 |
atgaccctttcaacaatgatgaaaaatgtgacctcattaattttccaagtgata |
58 |
Q |
|
|
||||||||||||||||||||||||| || ||| ||||||||||||||||||||| |
|
|
T |
5051096 |
atgaccctttcaacaatgatgaaaattgagacatcattaattttccaagtgata |
5051043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 51274347 - 51274399
Alignment:
Q |
5 |
atgaccctttcaacaatgatgaaaaatgtgacctcattaattttccaagtgat |
57 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
T |
51274347 |
atgaccctttcaacaatgatgaaaaatgtgaaatcattaattttcctagtgat |
51274399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19189 times since January 2019
Visitors: 2575