View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4352-Insertion-5 (Length: 148)
Name: 454-NF4352-Insertion-5
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4352-Insertion-5 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 8e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 8e-50
Query Start/End: Original strand, 5 - 108
Target Start/End: Original strand, 40058736 - 40058839
Alignment:
Q |
5 |
ccttgacccaacaaaacttgtcccacatgtctatcttcctagtagatgaaccactctcttatttgggaacatatgaaatgtacatcgagaatcaataacc |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
40058736 |
ccttgacccaacaaaacttgtcccacatgtctatcttcctagtagatgaaccactctcttatttgggaacatatgaaatgtacaacgagaatcaataacc |
40058835 |
T |
|
Q |
105 |
catt |
108 |
Q |
|
|
|||| |
|
|
T |
40058836 |
catt |
40058839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 93 - 148
Target Start/End: Original strand, 40059056 - 40059111
Alignment:
Q |
93 |
gaatcaataacccattcatgatgagttttatcttcaaggtatactccttcttaaga |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40059056 |
gaatcaataacccattcatgatgagttttatcttcaaggtatactccttcttaaga |
40059111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 44198 times since January 2019
Visitors: 7327