View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4353-Insertion-11 (Length: 197)
Name: 454-NF4353-Insertion-11
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4353-Insertion-11 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 7117694 - 7117499
Alignment:
Q |
1 |
tgtgcttctttacttttggtacaattagcttaaatcgacgagttccgactttgtctttctgcgcaagacaatgaccaacaacaacatacnnnnnnncctt |
100 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
7117694 |
tgtgcttctttacttttgggacaattagcttaaatcgacgagttccgactttgtctttctgcgcaagacaatgaccaacaacaacatacaaaaaaacctt |
7117595 |
T |
|
Q |
101 |
ccgatatttctcaatcatcaacgtcaaccacgtttccgtgccatgacaaacttttaggttcaatttagagccctcaaatccgagaaaaagaagata |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
7117594 |
ccgatatttctcaatcatcaacgtcaaccacgtttctgtgccatgacaaacttttaggttcaaattagagccctcaaatccgagaaaaagaagata |
7117499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2365 times since January 2019
Visitors: 6037