View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4354-Insertion-1 (Length: 54)
Name: 454-NF4354-Insertion-1
Description: 454-NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4354-Insertion-1 |
| |
|
[»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 48; Significance: 2e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-19
Query Start/End: Original strand, 7 - 54
Target Start/End: Original strand, 2982974 - 2983021
Alignment:
Q |
7 |
caatattgttacttgtataccattttgttctttttatcttcttgaaaa |
54 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2982974 |
caatattgttacttgtataccattttgttctttttatcttcttgaaaa |
2983021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 33580 times since January 2019
Visitors: 7044