View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: D682-LTR4-TNT-insertion-14 (Length: 210)
Name: D682-LTR4-TNT-insertion-14
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] D682-LTR4-TNT-insertion-14 |
| |
|
[»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0179 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 8 - 202
Target Start/End: Complemental strand, 3900 - 3706
Alignment:
Q |
8 |
ctagccaccaaaataagtgaaacaatgacacgaaataaaagattcggctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatct |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3900 |
ctagccaccaaaataagtgaaacaatgacacgaaataaaagattcagctgtgaaaataatgaaagataacttcaaaacgcaccaaataaaatatgcatct |
3801 |
T |
|
Q |
108 |
gggtatatgtcacctgtgtaaaaccttcttttctcttttgtccaatttttgccnnnnnnnccgtagcttctttgtgataccaatgactggtgatc |
202 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
3800 |
gggtatttgtcacctgtgtaaaaccttcttttctcttttgtccaatttttgcctttttttccgtagcttctttgtgataccaatgactggtgatc |
3706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 22705 times since January 2019
Visitors: 3335