View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: D682-LTR4-TNT-insertion-16 (Length: 255)
Name: D682-LTR4-TNT-insertion-16
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] D682-LTR4-TNT-insertion-16 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 28267582 - 28267342
Alignment:
Q |
8 |
gttataacagacaaagcgactgaaaacgcatcagtgtgtagctatataaggaaagtgatgaaactgcttttagttggtggagtgaaacccagagtagaaa |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
T |
28267582 |
gttataacagacaaagcgactgaaaacgcatcagtgtgtagctatataaggaaagtgatgaaactgcttttggttggtggagtgaaacccagagaagaaa |
28267483 |
T |
|
Q |
108 |
accactagtggttttaagagggatgccacgtggaccaataagggattgacatttcggaaaggatattcgtatgttgaagttcgtgtcaatcaccgttgca |
207 |
Q |
|
|
||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
28267482 |
accactagtggtttttagagggataccacgtggaccaataagagattgacatttcggaaaggatattcgtatgttgaagttcgtgttgatcaccgttgca |
28267383 |
T |
|
Q |
208 |
ttgctgacgcgtggtaatgcgattacgcaagccgtagatcg |
248 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
28267382 |
ttgctgacgcgtggtaatgcgtttacgcaagccgtagatcg |
28267342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12430 times since January 2019
Visitors: 5343