View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9045J-LTR4-TNT-insertion-4 (Length: 59)
Name: F9045J-LTR4-TNT-insertion-4
Description: F9045J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9045J-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 3579012 - 3578970
Alignment:
Q |
9 |
caacacctactactcatcatctcaccaagcattcctttgaatt |
51 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3579012 |
caacacctactactcatcatctcaccaagcattcctttgaatt |
3578970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 3e-16
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 45218252 - 45218294
Alignment:
Q |
9 |
caacacctactactcatcatctcaccaagcattcctttgaatt |
51 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45218252 |
caacacctactactcatcatctcaccaagcattcctttgaatt |
45218294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.00000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.00000006
Query Start/End: Original strand, 9 - 51
Target Start/End: Complemental strand, 3565253 - 3565214
Alignment:
Q |
9 |
caacacctactactcatcatctcaccaagcattcctttgaatt |
51 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
3565253 |
caacacctactactcatc---tcaccaagcattcctttgaatt |
3565214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 28751 times since January 2019
Visitors: 4004