View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-11 (Length: 216)
Name: F9049J-LTR4-TNT-insertion-11
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9049J-LTR4-TNT-insertion-11 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 8 - 209
Target Start/End: Original strand, 14987539 - 14987740
Alignment:
Q |
8 |
cttcccaatcgccctcatcactgccatgtccataaagttgtcaacaaccacagaaatgcatattttcaccagcatacnnnnnnnnncctggcaatacttg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
14987539 |
cttcccaatcgccctcatcactgccatgtccataaagttgtcaacaaccacagaaatgcatattttcaccagcatattttttttttcctggcaatacttg |
14987638 |
T |
|
Q |
108 |
gggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattcttcgaatatgcaatt |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14987639 |
gggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattcttcgaatatgcaatt |
14987738 |
T |
|
Q |
208 |
gg |
209 |
Q |
|
|
|| |
|
|
T |
14987739 |
gg |
14987740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 95 - 208
Target Start/End: Original strand, 34989494 - 34989607
Alignment:
Q |
95 |
ctggcaatacttggggcacggcttctgctatgctgagacttgaatcacttgacaaaccagaaaaaccataaccatccacaatacacgactcttcattctt |
194 |
Q |
|
|
||||||||| | |||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||| ||||| |||||||| ||| ||||||||||| |
|
|
T |
34989494 |
ctggcaataaattgggcacggcttcagctatgccgagacttgagtcacttgacaaaccagaaaaaccatcaccatgcacaatactcgattcttcattctt |
34989593 |
T |
|
Q |
195 |
cgaatatgcaattg |
208 |
Q |
|
|
|||| |||||||| |
|
|
T |
34989594 |
tgaatctgcaattg |
34989607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6099 times since January 2019
Visitors: 7727