View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-6 (Length: 166)
Name: F9049J-LTR4-TNT-insertion-6
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9049J-LTR4-TNT-insertion-6 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 5e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 5e-79
Query Start/End: Original strand, 9 - 157
Target Start/End: Original strand, 6820769 - 6820917
Alignment:
Q |
9 |
tacattggatcaaatgcataaccagcttcggaaagctgaagaaacagaagggataaaggcttgtgtaaagcaactaaaggtcattgttcatgagctggaa |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6820769 |
tacattggatcaaatgcataaccagcttcggaaagctgaagaaacagaagggataaaggcttgtgtaaagcaactaaaggtcattgttcatgagctggaa |
6820868 |
T |
|
Q |
109 |
aatttacaaccagaacagtatgtaactggcactgagttcaatccaattg |
157 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6820869 |
aatttacaaccagaacagtatgtaactggcactgagttcaatccaattg |
6820917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 20 - 87
Target Start/End: Original strand, 7333092 - 7333159
Alignment:
Q |
20 |
aaatgcataaccagcttcggaaagctgaagaaacagaagggataaaggcttgtgtaaagcaactaaag |
87 |
Q |
|
|
|||||||||| |||||| | |||| ||| ||||||||||| ||| |||||||||||| |||||||| |
|
|
T |
7333092 |
aaatgcataagcagcttaaggaagcagaaaaaacagaagggcgaaatgcttgtgtaaaggaactaaag |
7333159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2123 times since January 2019
Visitors: 6038