View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9091J-LTR4-TNT-insertion-4 (Length: 152)
Name: F9091J-LTR4-TNT-insertion-4
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9091J-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 4 - 142
Target Start/End: Complemental strand, 5461561 - 5461423
Alignment:
Q |
4 |
aacacgttcaaccaccgcgcacaccgaaaacagacagccgagagttcaaggaactcatgaagctggacctagtagaattagacatgttacacttggttag |
103 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5461561 |
aacaagttcaaccaccgcgcacaccgaaaacagacagccgagagttcaaggaactcatgaagctggacctagtagaattagacatgttacacttggttag |
5461462 |
T |
|
Q |
104 |
caatgtcagccattactgattattcacataacatcatta |
142 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5461461 |
caatgtcagccattactgattattcacataacatcatta |
5461423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 29759 times since January 2019
Visitors: 7506