View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9091J-LTR4-TNT-insertion-8 (Length: 139)
Name: F9091J-LTR4-TNT-insertion-8
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9091J-LTR4-TNT-insertion-8 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 10 - 129
Target Start/End: Original strand, 5332973 - 5333092
Alignment:
Q |
10 |
actcagtagagaaattaaattgaagaagnnnnnnnttactcataaattcatagtactctactagtcaaagtaaaggtaaactctggactgatacacttat |
109 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5332973 |
actcagtagagaaattaaattgaagaagaaaaaaattactcataaattcatagtactctactagtcaaagtaaaggtaaactctggactgatacacttat |
5333072 |
T |
|
Q |
110 |
ttttgcagaaaaagctatta |
129 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
5333073 |
ttttgcagaaaaagctatta |
5333092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2621 times since January 2019
Visitors: 7537