View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9096J-LTR4-TNT-insertion-4 (Length: 133)
Name: F9096J-LTR4-TNT-insertion-4
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9096J-LTR4-TNT-insertion-4 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 3e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 7 - 125
Target Start/End: Complemental strand, 24121217 - 24121099
Alignment:
Q |
7 |
aaaagcatgactgagttgaatgcagagagatgtttaacgtcacaggaactcaaaaacaaactaactaagcctcgtatttttgccaattttgaactcaaga |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24121217 |
aaaagcatgactgagttgaatgcagagagatgtttaacgtcacaggaactcaaaaacaaactaactaagcctcgtatttttgccaattttgaactcaaga |
24121118 |
T |
|
Q |
107 |
accagatactaccaattgg |
125 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
24121117 |
accagatactaccaattgg |
24121099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 9 - 125
Target Start/End: Complemental strand, 24153474 - 24153359
Alignment:
Q |
9 |
aagcatgactgagttgaatgcagagagatgtttaacgtcacaggaactcaaaaacaaactaactaagcctcgtatttttgccaattttgaactcaagaac |
108 |
Q |
|
|
||||||||||||||||| | ||||||||| |||| |||||| || ||||||||||||||| || ||| |||||||| | | ||| |||||| ||| |
|
|
T |
24153474 |
aagcatgactgagttgagttcagagagat-attaaggtcacaagatctcaaaaacaaactatgtagtcctggtatttttccaacatttcaactcagaaac |
24153376 |
T |
|
Q |
109 |
cagatactaccaattgg |
125 |
Q |
|
|
|||||||| |||||||| |
|
|
T |
24153375 |
cagatactgccaattgg |
24153359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20672 times since January 2019
Visitors: 2938