View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9119J-LTR4-TNT-insertion-2 (Length: 221)
Name: F9119J-LTR4-TNT-insertion-2
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9119J-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 2652192 - 2652393
Alignment:
| Q |
10 |
aatagatttatacgccaagaaaatgacaaagtggaccaggtaccttaaatgaaaaacatgggttcaatttctcaatgaatgtctctagaaagctgtaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2652192 |
aatagatttatacgccaagaaaatgacaaagtggaccaggtaccttaaatgaaaaacatgggttcaatttctcaatgaatgtctctagaaagctgtaatt |
2652291 |
T |
|
| Q |
110 |
ataatttgttgcaatgattgccatcaaaagatattagaacactcgtatgattactccttgcaagatagaatatagaaatcttagtcttggtgttcttgaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2652292 |
ataatttgttgcaatgattgccatcaaaagatattagaacactcgtatgattactccttgcaagatagaatatagaaatcttagtcttggtgttcttgaa |
2652391 |
T |
|
| Q |
210 |
tt |
211 |
Q |
| |
|
|| |
|
|
| T |
2652392 |
tt |
2652393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1298 times since January 2019
Visitors: 8571