View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9119J-LTR4-TNT-insertion-7 (Length: 299)
Name: F9119J-LTR4-TNT-insertion-7
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9119J-LTR4-TNT-insertion-7 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 8 - 291
Target Start/End: Complemental strand, 3440711 - 3440428
Alignment:
Q |
8 |
ggattgaggtatcaaagttggttaacgcctcactatcgctgccgattgaaccgtggtcactcaccagtcctaaaattttgcctaacaagtcgcaattctt |
107 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3440711 |
ggattgaggtatcaaagttggttaacgcttcactatcgctgccgattgaaccgtggtcactcaccagtcctaaaattttgcctaacaagtcgcaattctt |
3440612 |
T |
|
Q |
108 |
agctaaagctgggacttgactactaactctaggactaggtggagggtacaatctagccccagagtaaaagtttggaatagaatttgaaaggccttgaagg |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3440611 |
agctaaagctgggacttgactactaactctaggactaggtggagggtacaatctagccccagagtaaaagtttggaatagaatttgaaaggccttgaagg |
3440512 |
T |
|
Q |
208 |
gaccctaatagcttcagaaaaaccgacattgcaaaaaatgttgcacatcttgttgtgtccattttcttagttgttgtcacatta |
291 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3440511 |
gaccctaatagcttcagaaaaaccaacattgcaaaaaatgttgcacatcttgttgtgtccattttcttagttgttgtcacatta |
3440428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 42244 times since January 2019
Visitors: 7183