View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9119J-LTR4-TNT-insertion-8 (Length: 131)
Name: F9119J-LTR4-TNT-insertion-8
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9119J-LTR4-TNT-insertion-8 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 3e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 9 - 121
Target Start/End: Original strand, 38666809 - 38666921
Alignment:
Q |
9 |
cattgtcattgaattattatcaatggtcttggggtcatggacttattttgcaatcacttccaaatggtaatgcacctggatcaggaggaggagatcctac |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38666809 |
cattgtcattgaattattatcaatggtcttgggatcatggacttattttgcaatcacttccaaatggtaatgcacctggatcaggaggaggagatcctac |
38666908 |
T |
|
Q |
109 |
tcatccctaatta |
121 |
Q |
|
|
||||||||||||| |
|
|
T |
38666909 |
tcatccctaatta |
38666921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 9 - 121
Target Start/End: Original strand, 38674560 - 38674672
Alignment:
Q |
9 |
cattgtcattgaattattatcaatggtcttggggtcatggacttattttgcaatcacttccaaatggtaatgcacctggatcaggaggaggagatcctac |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38674560 |
cattgtcattgaattattatcaatggtcttgggatcatggacttattttgcaatcacttccaaatggtaatgcacctggatcaggaggaggagatcctac |
38674659 |
T |
|
Q |
109 |
tcatccctaatta |
121 |
Q |
|
|
||||||||||||| |
|
|
T |
38674660 |
tcatccctaatta |
38674672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 9 - 121
Target Start/End: Complemental strand, 38668862 - 38668750
Alignment:
Q |
9 |
cattgtcattgaattattatcaatggtcttggggtcatggacttattttgcaatcacttccaaatggtaatgcacctggatcaggaggaggagatcctac |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
T |
38668862 |
cattgtcattgaattattatcaatggtcttgggatcatggacttattttgcaatcacttccaaatggtaaagcacctggatcaagaggaggagatcctac |
38668763 |
T |
|
Q |
109 |
tcatccctaatta |
121 |
Q |
|
|
||||||||||||| |
|
|
T |
38668762 |
tcatccctaatta |
38668750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 43630 times since January 2019
Visitors: 7204