View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9140J-LTR4-TNT-insertion-1 (Length: 151)
Name: F9140J-LTR4-TNT-insertion-1
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9140J-LTR4-TNT-insertion-1 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 4e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 4e-36
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 36616136 - 36616212
Alignment:
Q |
8 |
ccaagcacaccaacacgcgcggaaaaccacctcagcagctgctggcaatgtataagttttctttgttttgcatttac |
84 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36616136 |
ccaagcacaccaacacgcgcggaaaaccacctcagcagctgctggcaatgtataagttttctttgttttgcatttac |
36616212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 35834 times since January 2019
Visitors: 7108