View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9140J-LTR4-TNT-insertion-5 (Length: 85)

Name: F9140J-LTR4-TNT-insertion-5
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9140J-LTR4-TNT-insertion-5
F9140J-LTR4-TNT-insertion-5
[»] chr3 (2 HSPs)
chr3 (8-35)||(39628803-39628830)
chr3 (54-85)||(39628848-39628879)


Alignment Details
Target: chr3 (Bit Score: 28; Significance: 0.0000004; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 35
Target Start/End: Original strand, 39628803 - 39628830
Alignment:
8 acttctaagtggacaaataatcgtcctt 35  Q
    ||||||||||||||||||||||||||||    
39628803 acttctaagtggacaaataatcgtcctt 39628830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 85
Target Start/End: Original strand, 39628848 - 39628879
Alignment:
54 tacacaaataatcaatagttatatttttggca 85  Q
    ||||||||||||| ||||||||||||||||||    
39628848 tacacaaataatcgatagttatatttttggca 39628879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 25872 times since January 2019
Visitors: 3898