View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9160J-LTR4-TNT-insertion-3 (Length: 126)
Name: F9160J-LTR4-TNT-insertion-3
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9160J-LTR4-TNT-insertion-3 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 9 - 116
Target Start/End: Original strand, 55289552 - 55289659
Alignment:
Q |
9 |
aataccaacctagaaagtgtagaggtagaattgtattttgtcggtgtattttgttggagcaaaataggaggaccattgccctgttcttattttaaggagc |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
55289552 |
aataccaacctagaaagtgtagaggtagaattgtattttgtcggtgtattttgttggagcaaaataggagggccattgccctgttcttattttaaggagc |
55289651 |
T |
|
Q |
109 |
actcatta |
116 |
Q |
|
|
|||||||| |
|
|
T |
55289652 |
actcatta |
55289659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2535 times since January 2019
Visitors: 6254