View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9160J-LTR4-TNT-insertion-7 (Length: 116)
Name: F9160J-LTR4-TNT-insertion-7
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9160J-LTR4-TNT-insertion-7 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 35124334 - 35124256
Alignment:
Q |
8 |
cactgtatgtggagtgttttaaactttggaataccattggtcatcttgtgcttgaagtgatttttttaattaacacctc |
86 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35124334 |
cactgtatgtggagtgttttaaactttggaataccattggtcatcttgtgcttgaagtgatttttttaattaacacctc |
35124256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21761 times since January 2019
Visitors: 3113