View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9160J-LTR4-TNT-insertion-8 (Length: 117)
Name: F9160J-LTR4-TNT-insertion-8
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9160J-LTR4-TNT-insertion-8 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 8 - 107
Target Start/End: Complemental strand, 42968491 - 42968392
Alignment:
Q |
8 |
gtcactgtgttctttcagttgctagtgtttctctcctccttctacttcattttgatgaactagctcttcacgagttcatggtagtcttcatttgcaattg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42968491 |
gtcactgtgttctttcagttgctagtgtttctctcctccttctacttcattttgatgaactagctcttcacgagttcatggtagtcttcatttgcaattg |
42968392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10073 times since January 2019
Visitors: 6811